grna-2 sequence Search Results


93
Addgene inc uhrf1 grna
(A) Illustration of the developmental stages and specification timing of the 7 major retinal cell types: retinal ganglion cells, amacrine, horizontal, bipolar, Müller, cone, and rod photoreceptors. (B) Time course of <t>Uhrf1</t> mRNA expression in the developing retina in wild-type mice. Levels of Uhrf1 mRNA were measured by RT-qPCR and normalized to the levels at E15.5 taken as 1 (n=3). Mean ± SD. (C) Representative Western blot analysis of UHRF1 protein levels with high and low exposure. Tubulin was used as loading control. (D) Quantification of the relative UHRF1 protein levels on Western blots, were E15.5 was taken as 1 (n=3). Mean ± SD.
Uhrf1 Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/bio_rxiv__2025__03__02__641083-265-0-18?v=Addgene+inc
Average 93 stars, based on 1 article reviews
uhrf1 grna - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc sacas9
( A–G ) GFP expression in a cynomolgus macaque injected with ~2.6E + 12 vg of K912-scCAG-GFP. ( A ) GFP expression in a flatmounted cynomolgus macaque retina 2.5 months after injection. ( B ) GFP expression in the perifoveal ring. ( C ) GFP expression in peripheral retina. ( D ) Flatmount imaged through the photoreceptor layer in peripheral retina showing GFP expression and PNA labeling of cones. ( E ) Higher resolution image of peripheral photoreceptors, labeled with PNA. ( F ) Cross section of peripheral retina showing GFP expression and DAPI labeling of nuclei. ( G ) Cross-section through the foveal edge showing GFP expression. Cone outer segments are labeled with PNA. Nuclei are labeled with DAPI. ( H ) RT-PCR of cDNA from injected and uninjected eyes. RT-PCR shows Cas9 expression in macula of the cynomolgus macaque retina injected with <t>K912-saCas9-gRNA-</t> RHO but not in a control uninjected eye. ( I ) Percent of genome editing and location of editing relative to guide RNA sequence in two macaques injected with K912-scCAG-saCA9-gRNA- RHO . ( J ) Deep sequencing reads showing deletions, insertions and base substitutions in the cynomolgus macaque and rhesus macaque following injection with K912-saCas9-gRNA- RHO .
Sacas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc08612735-7-18-6?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sacas9 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
GenScript corporation grna-2
( A–G ) GFP expression in a cynomolgus macaque injected with ~2.6E + 12 vg of K912-scCAG-GFP. ( A ) GFP expression in a flatmounted cynomolgus macaque retina 2.5 months after injection. ( B ) GFP expression in the perifoveal ring. ( C ) GFP expression in peripheral retina. ( D ) Flatmount imaged through the photoreceptor layer in peripheral retina showing GFP expression and PNA labeling of cones. ( E ) Higher resolution image of peripheral photoreceptors, labeled with PNA. ( F ) Cross section of peripheral retina showing GFP expression and DAPI labeling of nuclei. ( G ) Cross-section through the foveal edge showing GFP expression. Cone outer segments are labeled with PNA. Nuclei are labeled with DAPI. ( H ) RT-PCR of cDNA from injected and uninjected eyes. RT-PCR shows Cas9 expression in macula of the cynomolgus macaque retina injected with <t>K912-saCas9-gRNA-</t> RHO but not in a control uninjected eye. ( I ) Percent of genome editing and location of editing relative to guide RNA sequence in two macaques injected with K912-scCAG-saCA9-gRNA- RHO . ( J ) Deep sequencing reads showing deletions, insertions and base substitutions in the cynomolgus macaque and rhesus macaque following injection with K912-saCas9-gRNA- RHO .
Grna 2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc10192333-274-1-26?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
grna-2 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

99
ATCC non targeting grna2

Non Targeting Grna2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc06499541-15-7-24?v=ATCC
Average 99 stars, based on 1 article reviews
non targeting grna2 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

92
ATCC targeting grna2

Targeting Grna2, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pmc06499541-15-47-24?v=ATCC
Average 92 stars, based on 1 article reviews
targeting grna2 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

94
Addgene inc flag

Flag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/pm37178686-167-138-143?v=Addgene+inc
Average 94 stars, based on 1 article reviews
flag - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results


(A) Illustration of the developmental stages and specification timing of the 7 major retinal cell types: retinal ganglion cells, amacrine, horizontal, bipolar, Müller, cone, and rod photoreceptors. (B) Time course of Uhrf1 mRNA expression in the developing retina in wild-type mice. Levels of Uhrf1 mRNA were measured by RT-qPCR and normalized to the levels at E15.5 taken as 1 (n=3). Mean ± SD. (C) Representative Western blot analysis of UHRF1 protein levels with high and low exposure. Tubulin was used as loading control. (D) Quantification of the relative UHRF1 protein levels on Western blots, were E15.5 was taken as 1 (n=3). Mean ± SD.

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Illustration of the developmental stages and specification timing of the 7 major retinal cell types: retinal ganglion cells, amacrine, horizontal, bipolar, Müller, cone, and rod photoreceptors. (B) Time course of Uhrf1 mRNA expression in the developing retina in wild-type mice. Levels of Uhrf1 mRNA were measured by RT-qPCR and normalized to the levels at E15.5 taken as 1 (n=3). Mean ± SD. (C) Representative Western blot analysis of UHRF1 protein levels with high and low exposure. Tubulin was used as loading control. (D) Quantification of the relative UHRF1 protein levels on Western blots, were E15.5 was taken as 1 (n=3). Mean ± SD.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Control

(A) Schematic diagram of conditional excision of the floxed Uhrf1 allele. (B) Western blot analysis of Uhrf1 expression in Uhrf1 cKO (Chx10- Cre Uhrf1 lox/lox ) and littermate control ( Uhrf1 lox/lox ) shows effective reduction of Uhrf1 protein upon Cre recombination of floxed Uhrf1 alleles. Actin was used as loading control. (C) RT-qPCR analysis of retinal cell marker genes. A significant increase in the mRNA level of Chx10 (bipolar), Prkca (bipolar) , Prox1 (amacrine/horizontal) and a significant decrease in rhodopsin (rods) transcription were observed in Uhrf1 cKO EGFP+ cells compared to the control littermates. All data are normalized to control littermates (n=4). *p<0.05 by unpaired two-tailed t test. (D-E) Representative images of P21 retina cross-sections (D) and dissociated cells (E) from Uhrf1 cKO Z/EG mice immunostained with recoverin (photoreceptors), cone-arrestin (cone photoreceptors), calbindin (horizontal and a subset of amacrine cells), chx10 (bipolar), and pkc-alpha (bipolar) antibodies (red). Retinae were double immunostained with anti-GFP to capture areas of Chx10-Cre -mediated GFP expression. Nuclei were counterstained with DAPI (blue). ONL, outer nuclear layer; INL, inner nuclear layer; GCL ganglion cell layer; ipl, inner plexiform layer; opl, outer plexiform layer. (F) Quantification of the proportion of immunoreactive cells for each cellular marker antibody shown in E and supplemental figure 3 was determined for EGFP+ and EGFP-cells from Uhrf1 cKO Z/EG mice from independent litters (n=3). Each bar represents the mean ± SD of 500 cells scored from each retina. (G-H) ERGs were recorded from 5-week-old Uhrf1 cKO (red line) and littermate control (black line). a-wave amplitude (G) and b-wave amplitude (H) were recorded at various light intensities. All measurements are mean ± SD (n=4).

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Schematic diagram of conditional excision of the floxed Uhrf1 allele. (B) Western blot analysis of Uhrf1 expression in Uhrf1 cKO (Chx10- Cre Uhrf1 lox/lox ) and littermate control ( Uhrf1 lox/lox ) shows effective reduction of Uhrf1 protein upon Cre recombination of floxed Uhrf1 alleles. Actin was used as loading control. (C) RT-qPCR analysis of retinal cell marker genes. A significant increase in the mRNA level of Chx10 (bipolar), Prkca (bipolar) , Prox1 (amacrine/horizontal) and a significant decrease in rhodopsin (rods) transcription were observed in Uhrf1 cKO EGFP+ cells compared to the control littermates. All data are normalized to control littermates (n=4). *p<0.05 by unpaired two-tailed t test. (D-E) Representative images of P21 retina cross-sections (D) and dissociated cells (E) from Uhrf1 cKO Z/EG mice immunostained with recoverin (photoreceptors), cone-arrestin (cone photoreceptors), calbindin (horizontal and a subset of amacrine cells), chx10 (bipolar), and pkc-alpha (bipolar) antibodies (red). Retinae were double immunostained with anti-GFP to capture areas of Chx10-Cre -mediated GFP expression. Nuclei were counterstained with DAPI (blue). ONL, outer nuclear layer; INL, inner nuclear layer; GCL ganglion cell layer; ipl, inner plexiform layer; opl, outer plexiform layer. (F) Quantification of the proportion of immunoreactive cells for each cellular marker antibody shown in E and supplemental figure 3 was determined for EGFP+ and EGFP-cells from Uhrf1 cKO Z/EG mice from independent litters (n=3). Each bar represents the mean ± SD of 500 cells scored from each retina. (G-H) ERGs were recorded from 5-week-old Uhrf1 cKO (red line) and littermate control (black line). a-wave amplitude (G) and b-wave amplitude (H) were recorded at various light intensities. All measurements are mean ± SD (n=4).

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Marker, Two Tailed Test

(A-B) Uhrf1 protein level in P21 retinae and retinoblastoma tumor samples were compared to littermate controls (wt). Tubulin was used as loading control. (C) Chromatin immunoprecipitation (ChIP) assay in P0 mouse retinae and Weri retinoblastoma human cell line reveals enrichment of E2f1 within the Uhrf1 promoter. (D-E) Western blot analysis of Uhrf1 protein level in different retinae development stages in Rb1 cKO mice and Rb1/Rbl1 cDKO. Tubulin was used as loading control. (F) Quantification of Uhrf1 protein expression in Rb/Rbl1 cDKO. (G) RT-qPCR analysis of Uhrf1 mRNA level in Rb1/Rbl1 cDKO. Uhrf1 mRNA level in E17.5 wt mouse was set as 1. (H) Representative sequencing tracks for the Uhrf1 locus show increased peaks at the promoter in P21 Rb1/Rbl1 DKO mouse retinal cells (EGFP+) compared to control retinal cells (EGFP-). The ATAC-Seq data have been normalized to take sequencing depth into account. All measurements are mean ± SD (n=3).

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A-B) Uhrf1 protein level in P21 retinae and retinoblastoma tumor samples were compared to littermate controls (wt). Tubulin was used as loading control. (C) Chromatin immunoprecipitation (ChIP) assay in P0 mouse retinae and Weri retinoblastoma human cell line reveals enrichment of E2f1 within the Uhrf1 promoter. (D-E) Western blot analysis of Uhrf1 protein level in different retinae development stages in Rb1 cKO mice and Rb1/Rbl1 cDKO. Tubulin was used as loading control. (F) Quantification of Uhrf1 protein expression in Rb/Rbl1 cDKO. (G) RT-qPCR analysis of Uhrf1 mRNA level in Rb1/Rbl1 cDKO. Uhrf1 mRNA level in E17.5 wt mouse was set as 1. (H) Representative sequencing tracks for the Uhrf1 locus show increased peaks at the promoter in P21 Rb1/Rbl1 DKO mouse retinal cells (EGFP+) compared to control retinal cells (EGFP-). The ATAC-Seq data have been normalized to take sequencing depth into account. All measurements are mean ± SD (n=3).

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Control, Chromatin Immunoprecipitation, Western Blot, Expressing, Quantitative RT-PCR, Sequencing

(A) Kaplan-Meier curves showing the percentage of mice free of visible retinoblastoma tumors in Rb1/Rbl1 DKO (n=52) and Rb1/Rbl1/Uhrf1 (n=41) mice. (B) Volcano plot of differentially expressed genes (DEGs) in Rb1/Rbl1/Uhrf1 TKO compared to Rb1/Rbl1 DKO P21 mouse retinae. (C-D) p-value ranking bar graph representing the ten most significant gene ontology (GO) biological processes for (C) upregulated genes and (D) downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (E) Genome-wide heatmap plot of chromatin accessibility peaks (ATAC-seq) from flow sorted EGFP-negative ( Cre -negative) Rb1/Rbl1/Uhrf1 and EGFP-positive Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO P21 retina grouped by mean reads and by distance from the transcription starting site (TSS). Each row represents a gene ordered in descending accessibility mean reads. (F) Heat map of differentially methylated genes in Cre -positive Rb1/Rbl1/Uhrf1 , Rb1/Rbl1 DKO and Cre -negative Rb1/Rbl1/Uhrf1 TKO P21 retina. (G-H) Representative images of (G) P12 retina and (H) P21 retina cross-sections from Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO mice labeled with EdU (proliferating cells; red). Nuclei were counterstained with DAPI (blue). (I-J) Quantification of the proportion of EdU positive cells in (I) P12 and (J) P21 Rb/Rbl1 cDKO and dissociated retina Each bar represents the mean ± SD of 500 cells scored from each retina. (n=3). *p<0.05, **p<0.01 by unpaired two-tailed t test.

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Kaplan-Meier curves showing the percentage of mice free of visible retinoblastoma tumors in Rb1/Rbl1 DKO (n=52) and Rb1/Rbl1/Uhrf1 (n=41) mice. (B) Volcano plot of differentially expressed genes (DEGs) in Rb1/Rbl1/Uhrf1 TKO compared to Rb1/Rbl1 DKO P21 mouse retinae. (C-D) p-value ranking bar graph representing the ten most significant gene ontology (GO) biological processes for (C) upregulated genes and (D) downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (E) Genome-wide heatmap plot of chromatin accessibility peaks (ATAC-seq) from flow sorted EGFP-negative ( Cre -negative) Rb1/Rbl1/Uhrf1 and EGFP-positive Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO P21 retina grouped by mean reads and by distance from the transcription starting site (TSS). Each row represents a gene ordered in descending accessibility mean reads. (F) Heat map of differentially methylated genes in Cre -positive Rb1/Rbl1/Uhrf1 , Rb1/Rbl1 DKO and Cre -negative Rb1/Rbl1/Uhrf1 TKO P21 retina. (G-H) Representative images of (G) P12 retina and (H) P21 retina cross-sections from Rb1/Rbl1 DKO and Rb1/Rbl1/Uhrf1 TKO mice labeled with EdU (proliferating cells; red). Nuclei were counterstained with DAPI (blue). (I-J) Quantification of the proportion of EdU positive cells in (I) P12 and (J) P21 Rb/Rbl1 cDKO and dissociated retina Each bar represents the mean ± SD of 500 cells scored from each retina. (n=3). *p<0.05, **p<0.01 by unpaired two-tailed t test.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: Genome Wide, Methylation, Labeling, Two Tailed Test

(A) p-value ranking bar graph representing the ten most significant cell types for downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (B) Gene Set Enrichment Analysis (GSEA) enrichment plot of the fetal eye microglia gene cluster from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (C) Western blot analysis of Uhrf1 protein level in VC or Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (D) Representative bioluminescent images from mice orthotopically implanted with VC or Uhrf1 KO UCI-Rb-1 cells at 2-weeks post sub-retinal injection. (E) Quantification of the percentage of mice presenting tumors at 2-weeks post implantation with either 150000 (150K) or 100000 (100K) cells in immune-competent mice. (F) Quantification of the final tumor weight at 2 weeks post implantation. (G) Schematic workflow of the immune flow analysis of retinoblastoma tumors derived from VC and Uhrf1 KO UCI-Rb-1 cells after 2 weeks post-implantation. (H-O) Quantification of the percentage of (H) live cells, (I) leukocytes, (J) microglia, (K) myeloid cells, (L) dendritic cells, (M) T-cell, (N) helper T cells, and (O) cytotoxic T cells. Lines represent median ± SD. VC shown in black dots (n=12) and Uhrf1 KO shown in red dots (n=8). For all graphs: ns=not significant, *p<0.05 by unpaired two-tailed t test.

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) p-value ranking bar graph representing the ten most significant cell types for downregulated genes in Rb1/Rbl1/Uhrf1 TKO compared with Rb1/Rbl1 DKO P21 retinae. (B) Gene Set Enrichment Analysis (GSEA) enrichment plot of the fetal eye microglia gene cluster from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (C) Western blot analysis of Uhrf1 protein level in VC or Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (D) Representative bioluminescent images from mice orthotopically implanted with VC or Uhrf1 KO UCI-Rb-1 cells at 2-weeks post sub-retinal injection. (E) Quantification of the percentage of mice presenting tumors at 2-weeks post implantation with either 150000 (150K) or 100000 (100K) cells in immune-competent mice. (F) Quantification of the final tumor weight at 2 weeks post implantation. (G) Schematic workflow of the immune flow analysis of retinoblastoma tumors derived from VC and Uhrf1 KO UCI-Rb-1 cells after 2 weeks post-implantation. (H-O) Quantification of the percentage of (H) live cells, (I) leukocytes, (J) microglia, (K) myeloid cells, (L) dendritic cells, (M) T-cell, (N) helper T cells, and (O) cytotoxic T cells. Lines represent median ± SD. VC shown in black dots (n=12) and Uhrf1 KO shown in red dots (n=8). For all graphs: ns=not significant, *p<0.05 by unpaired two-tailed t test.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: RNA Sequencing, Western Blot, Control, Injection, Derivative Assay, Two Tailed Test

(A) Gene Set Enrichment Analysis (GSEA) enrichment plot of gene ontology for biological process for positive regulation of chemokine production from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (B) Chemokine immunoassay analysis from conditioned media from VC and Uhrf1 KO UCI-Rb-1 cells. (C) Quantification of the chemokines identified in B. (n=2 independent batches). mean ± SD *p<0.05 by unpaired two-tailed t test. (D) GSEA enrichment plot for the hallmark for TNF alpha signaling via NF-kB from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (E) Western blot analysis of NF-kB family proteins level in VC and Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (F) Schematic summary of the role of Uhrf1 in retinoblastomagenesis.

Journal: bioRxiv

Article Title: UHRF1 is critical for tumor-promoting inflammation and tumorigenesis in retinoblastoma

doi: 10.1101/2025.03.02.641083

Figure Lengend Snippet: (A) Gene Set Enrichment Analysis (GSEA) enrichment plot of gene ontology for biological process for positive regulation of chemokine production from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (B) Chemokine immunoassay analysis from conditioned media from VC and Uhrf1 KO UCI-Rb-1 cells. (C) Quantification of the chemokines identified in B. (n=2 independent batches). mean ± SD *p<0.05 by unpaired two-tailed t test. (D) GSEA enrichment plot for the hallmark for TNF alpha signaling via NF-kB from the RNA-seq data comparing Rb1/Rbl1/Uhrf1 TKO to Rb1/Rbl1 DKO P21 retinae. (E) Western blot analysis of NF-kB family proteins level in VC and Uhrf1 KO UCI-Rb-1. Actin was used as loading control. (F) Schematic summary of the role of Uhrf1 in retinoblastomagenesis.

Article Snippet: Uhrf1 gRNA (gRNA1 sequence: TGATTGAGCTCCCTAAAGAG and gRNA2 sequence: GGTCATGGCCAACTATAACG) was cloned into the doxycycline-inducible CRISPR/Cas9 plasmid TLCV2 (87360, Addgene). pLenti PGK V5-LUC Neo (21471, Addgene) was used for bioluminescence imaging.

Techniques: RNA Sequencing, Two Tailed Test, Western Blot, Control

( A–G ) GFP expression in a cynomolgus macaque injected with ~2.6E + 12 vg of K912-scCAG-GFP. ( A ) GFP expression in a flatmounted cynomolgus macaque retina 2.5 months after injection. ( B ) GFP expression in the perifoveal ring. ( C ) GFP expression in peripheral retina. ( D ) Flatmount imaged through the photoreceptor layer in peripheral retina showing GFP expression and PNA labeling of cones. ( E ) Higher resolution image of peripheral photoreceptors, labeled with PNA. ( F ) Cross section of peripheral retina showing GFP expression and DAPI labeling of nuclei. ( G ) Cross-section through the foveal edge showing GFP expression. Cone outer segments are labeled with PNA. Nuclei are labeled with DAPI. ( H ) RT-PCR of cDNA from injected and uninjected eyes. RT-PCR shows Cas9 expression in macula of the cynomolgus macaque retina injected with K912-saCas9-gRNA- RHO but not in a control uninjected eye. ( I ) Percent of genome editing and location of editing relative to guide RNA sequence in two macaques injected with K912-scCAG-saCA9-gRNA- RHO . ( J ) Deep sequencing reads showing deletions, insertions and base substitutions in the cynomolgus macaque and rhesus macaque following injection with K912-saCas9-gRNA- RHO .

Journal: eLife

Article Title: scAAVengr, a transcriptome-based pipeline for quantitative ranking of engineered AAVs with single-cell resolution

doi: 10.7554/eLife.64175

Figure Lengend Snippet: ( A–G ) GFP expression in a cynomolgus macaque injected with ~2.6E + 12 vg of K912-scCAG-GFP. ( A ) GFP expression in a flatmounted cynomolgus macaque retina 2.5 months after injection. ( B ) GFP expression in the perifoveal ring. ( C ) GFP expression in peripheral retina. ( D ) Flatmount imaged through the photoreceptor layer in peripheral retina showing GFP expression and PNA labeling of cones. ( E ) Higher resolution image of peripheral photoreceptors, labeled with PNA. ( F ) Cross section of peripheral retina showing GFP expression and DAPI labeling of nuclei. ( G ) Cross-section through the foveal edge showing GFP expression. Cone outer segments are labeled with PNA. Nuclei are labeled with DAPI. ( H ) RT-PCR of cDNA from injected and uninjected eyes. RT-PCR shows Cas9 expression in macula of the cynomolgus macaque retina injected with K912-saCas9-gRNA- RHO but not in a control uninjected eye. ( I ) Percent of genome editing and location of editing relative to guide RNA sequence in two macaques injected with K912-scCAG-saCA9-gRNA- RHO . ( J ) Deep sequencing reads showing deletions, insertions and base substitutions in the cynomolgus macaque and rhesus macaque following injection with K912-saCas9-gRNA- RHO .

Article Snippet: Recombinant DNA reagent , pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA , Addgene , Plasmid #61591RRID: Addgene_61591 , A single vector AAV-Cas9 system containing SaCas9 and its sgRNA.

Techniques: Expressing, Injection, Labeling, Reverse Transcription Polymerase Chain Reaction, Sequencing

Journal: eLife

Article Title: scAAVengr, a transcriptome-based pipeline for quantitative ranking of engineered AAVs with single-cell resolution

doi: 10.7554/eLife.64175

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA , Addgene , Plasmid #61591RRID: Addgene_61591 , A single vector AAV-Cas9 system containing SaCas9 and its sgRNA.

Techniques: Recombinant, Plasmid Preparation, Quantitation Assay, DNA Extraction, Expressing, Software, RNA Sequencing Assay, Sequencing

Journal: eLife

Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development

doi: 10.7554/eLife.30454

Figure Lengend Snippet:

Article Snippet: Cell line ( Homo sapiens ) , Non-targeting gRNA2. Pool of HUVEC/TERT2 cells. , This paper , , Derived from HUVEC/TERT 2 cell line (ATCC CRL4053). Cells were grown under blasticidin (4 μg/ml) selection and used between 7th-10th passages. Cells are stably coexpressing Cas9 nuclease and non- targeting gRNA2 (from Torres-Vázquez lab plasmid #1860).

Techniques: Transgenic Assay, Plasmid Preparation, Mutagenesis, Derivative Assay, Selection, Stable Transfection, Knock-Out, Recombinant, Control, shRNA, Sequencing, Construct, Synthesized, Positive Control, Sterility, Concentration Assay

Journal: eLife

Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development

doi: 10.7554/eLife.30454

Figure Lengend Snippet:

Article Snippet: Cell line ( Homo sapiens ) , Non-targeting gRNA2. Pool of HUVEC/TERT2 cells. , This paper , , Derived from HUVEC/TERT 2 cell line (ATCC CRL4053). Cells were grown under blasticidin (4 μg/ml) selection and used between 7th-10th passages. Cells are stably coexpressing Cas9 nuclease and non- targeting gRNA2 (from Torres-Vázquez lab plasmid #1860).

Techniques: Transgenic Assay, Plasmid Preparation, Mutagenesis, Derivative Assay, Selection, Stable Transfection, Knock-Out, Recombinant, Control, shRNA, Sequencing, Construct, Synthesized, Positive Control, Sterility, Concentration Assay